Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9415006
End position: 9415050
Length: 45

DNA sequence
>NC_018266, from 9415006 to 9415050 (45 bp); Amycolatopsis mediterranei S699 GGGCGACGGCGAGCTCGGCGACGGCGGGGTGGGCGACGAAGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9414641-9415255	Sequence	AMES_8435 - hypothetical protein (Protein is coded in complementary strand; from 9415255 to 9414641)