Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9406257
End position: 9406280
Length: 24

DNA sequence
>NC_018266, from 9406257 to 9406280 (24 bp); Amycolatopsis mediterranei S699 CTGCGCCTGCGACTGCACCTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9405715-9406392	Sequence	AMES_8427 - hypothetical protein (Protein is coded in complementary strand; from 9406392 to 9405715)