Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9403341
End position: 9403364
Length: 24

DNA sequence
>NC_018266, from 9403341 to 9403364 (24 bp); Amycolatopsis mediterranei S699 GCCGCCGCCACCGCTGCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9403231-9404697	Sequence	AMES_8424 - serine/threonine protein kinase (Protein is coded in complementary strand; from 9404697 to 9403231)