Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9372707
End position: 9372751
Length: 45

DNA sequence
>NC_018266, from 9372707 to 9372751 (45 bp); Amycolatopsis mediterranei S699 CCGGGGCGGGCGGCCGCGGCGCGGGCGGGCGCGGTGCGGGCGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9372166-9373647	Sequence	AMES_8396 - hypothetical protein (Protein is coded in complementary strand; from 9373647 to 9372166)