Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 933889
End position: 933918
Length: 30

DNA sequence
>NC_018266, from 933889 to 933918 (30 bp); Amycolatopsis mediterranei S699 CCTCGTCCTCTTCCTCTTCCTCGTCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 933327-934598	Sequence	AMES_0862 - hypothetical protein (Protein is coded in complementary strand; from 934598 to 933327)