Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9251796
End position: 9251819
Length: 24

DNA sequence
>NC_018266, from 9251796 to 9251819 (24 bp); Amycolatopsis mediterranei S699 CCGGCCGCCCGGCAGCTCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9251173-9252390	Sequence	AMES_8274 entC isochorismate synthase (Protein is coded in complementary strand; from 9252390 to 9251173)