Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9108138
End position: 9108200
Length: 63

DNA sequence
>NC_018266, from 9108138 to 9108200 (63 bp); Amycolatopsis mediterranei S699 TCACGCGAACCGACCCTCCAGGCACGCGAGCCGACCGTCCGGGTACGCGAGCCGACCCTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9107214-9108230	Sequence	AMES_8143 rpoE RNA polymerase sigma-70 factor, ECF subfamily