Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8929158
End position: 8929202
Length: 45

DNA sequence
>NC_018266, from 8929158 to 8929202 (45 bp); Amycolatopsis mediterranei S699 GGGCTGGCCGGGCGGGAACTGGCCCGGCGGGAACTGGCCGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8928607-8929317	Sequence	AMES_7987 - hypothetical protein (Protein is coded in complementary strand; from 8929317 to 8928607)