Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8864274
End position: 8864297
Length: 24

DNA sequence
>NC_018266, from 8864274 to 8864297 (24 bp); Amycolatopsis mediterranei S699 CGCCAGCCCCAGCGCGAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8864035-8866986	Sequence	AMES_7930 sbcC exonuclease SbcC (Protein is coded in complementary strand; from 8866986 to 8864035)