Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8855805
End position: 8855828
Length: 24

DNA sequence
>NC_018266, from 8855805 to 8855828 (24 bp); Amycolatopsis mediterranei S699 GCGCCAGCGCCCGGGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8855243-8856250	Sequence	AMES_7920 - spermidine/putrescine ABC transporter ATPase (Protein is coded in complementary strand; from 8856250 to 8855243)