Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8838159
End position: 8838221
Length: 63

DNA sequence
>NC_018266, from 8838159 to 8838221 (63 bp); Amycolatopsis mediterranei S699 CGCGTGTCGTCCATCTGCGTACGCGTGTCGTCGGGCTGCGTACGCGTGTCGTCCGTCAGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 8838215-8839231	Sequence	AMES_7906 - dipeptide/oligopeptide/nickel ABC transporter permease (Protein is coded in complementary strand; from 8839231 to 8838215)