Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8798242
End position: 8798265
Length: 24

DNA sequence
>NC_018266, from 8798242 to 8798265 (24 bp); Amycolatopsis mediterranei S699 CACCGCCACCGCCTCCGCCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8797556-8798560	Sequence	AMES_7871 - hypothetical protein (Protein is coded in complementary strand; from 8798560 to 8797556)