Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8682660
End position: 8682683
Length: 24

DNA sequence
>NC_018266, from 8682660 to 8682683 (24 bp); Amycolatopsis mediterranei S699 GCCGCCGCCGCGGTCGCCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8682238-8683800	Sequence	AMES_7766 ilvB acetolactate synthase I/II/III large subunit