Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 865538
End position: 865561
Length: 24

DNA sequence
>NC_018266, from 865538 to 865561 (24 bp); Amycolatopsis mediterranei S699 CGATGGCGTTGGCGATGTCGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 865249-865929	Sequence	AMES_0797 - metalloendopeptidase-like membrane protein (Protein is coded in complementary strand; from 865929 to 865249)