Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 853429
End position: 853453
Length: 25

DNA sequence
>NC_018266, from 853429 to 853453 (25 bp); Amycolatopsis mediterranei S699 GCAGCCCAGCGCACCCCAGCTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 852989-853894	Sequence	AMES_0786 - hypothetical protein (Protein is coded in complementary strand; from 853894 to 852989)