Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8495725
End position: 8495748
Length: 24

DNA sequence
>NC_018266, from 8495725 to 8495748 (24 bp); Amycolatopsis mediterranei S699 CGGCGACGGCGTCGACGACCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8495415-8496497	Sequence	AMES_7579 - aldo/keto reductase (Protein is coded in complementary strand; from 8496497 to 8495415)