Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8466790
End position: 8466813
Length: 24

DNA sequence
>NC_018266, from 8466790 to 8466813 (24 bp); Amycolatopsis mediterranei S699 CGCGACCGCGATCGCGGCTGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8466167-8466937	Sequence	AMES_7549 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 8466937 to 8466167)