Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8421958
End position: 8421981
Length: 24

DNA sequence
>NC_018266, from 8421958 to 8421981 (24 bp); Amycolatopsis mediterranei S699 CCCGACCGCGACGCCGACCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8421860-8422675	Sequence	AMES_7504 - ABC transporter permease (Protein is coded in complementary strand; from 8422675 to 8421860)