Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8416644
End position: 8416667
Length: 24

DNA sequence
>NC_018266, from 8416644 to 8416667 (24 bp); Amycolatopsis mediterranei S699 CGACGACGGCGATGACGACGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8415596-8416702	Sequence	AMES_7498 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 8416702 to 8415596)