Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8402654
End position: 8402698
Length: 45

DNA sequence
>NC_018266, from 8402654 to 8402698 (45 bp); Amycolatopsis mediterranei S699 CCGGCGGCGTGGTCGTCGGCGGGGTGGTGGCAGGCGGGGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8402116-8403330	Sequence	AMES_7486 - hypothetical protein (Protein is coded in complementary strand; from 8403330 to 8402116)