Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8384791
End position: 8384817
Length: 27

DNA sequence
>NC_018266, from 8384791 to 8384817 (27 bp); Amycolatopsis mediterranei S699 ACCGGGGGCACCGGGCGCACCGGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8383523-8385289	Sequence	AMES_7469 - chitinase (Protein is coded in complementary strand; from 8385289 to 8383523)