Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8346825
End position: 8346869
Length: 45

DNA sequence
>NC_018266, from 8346825 to 8346869 (45 bp); Amycolatopsis mediterranei S699 GCTGGTCGTACTGCTGCTGGTCGTACTGCTGCTGGTCGTACTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8345636-8347012	Sequence	AMES_7435 - serine protease (Protein is coded in complementary strand; from 8347012 to 8345636)