Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8315871
End position: 8315906
Length: 36

DNA sequence
>NC_018266, from 8315871 to 8315906 (36 bp); Amycolatopsis mediterranei S699 CACTGACCGGCGCTTTGACCGGCGCTTTGACCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8315485-8315877	Sequence	AMES_7409 - hypothetical protein
ORF. 8315871-8317256	Sequence	AMES_7408 - amino acid decarboxylase, pyridoxal-dependent protein (Protein is coded in complementary strand; from 8317256 to 8315871)