Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8305685
End position: 8305708
Length: 24

DNA sequence
>NC_018266, from 8305685 to 8305708 (24 bp); Amycolatopsis mediterranei S699 CGAGGTCGAGCTCGAGGACGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8305495-8306139	Sequence	AMES_7399 rpoE RNA polymerase sigma-70 factor, ECF subfamily (Protein is coded in complementary strand; from 8306139 to 8305495)