Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8304486
End position: 8304515
Length: 30

DNA sequence
>NC_018266, from 8304486 to 8304515 (30 bp); Amycolatopsis mediterranei S699 GACGTCGACGTCGACGTCGACGTCGACGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8304376-8304573	Sequence	AMES_7395 - hypothetical protein (Protein is coded in complementary strand; from 8304573 to 8304376)