Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8262426
End position: 8262449
Length: 24

DNA sequence
>NC_018266, from 8262426 to 8262449 (24 bp); Amycolatopsis mediterranei S699 ACGGCGAGGGCGATGGCGAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8261034-8263229	Sequence	AMES_7358 - two-component system histidine kinase (Protein is coded in complementary strand; from 8263229 to 8261034)