Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 825585
End position: 825608
Length: 24

DNA sequence
>NC_018266, from 825585 to 825608 (24 bp); Amycolatopsis mediterranei S699 TGGCGATGGCCACGGCGATGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 825446-826510	Sequence	AMES_0757 - arsenite efflux pump (Protein is coded in complementary strand; from 826510 to 825446)