Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8205465
End position: 8205488
Length: 24

DNA sequence
>NC_018266, from 8205465 to 8205488 (24 bp); Amycolatopsis mediterranei S699 CGACGACGACGGCCACGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8205383-8205940	Sequence	AMES_7305 - hypothetical protein (Protein is coded in complementary strand; from 8205940 to 8205383)