Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 8114891
End position: 8114914
Length: 24

DNA sequence
>NC_018266, from 8114891 to 8114914 (24 bp); Amycolatopsis mediterranei S699 CGACGACCACGACGGCGACGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8113639-8120217	Sequence	AMES_7238 - RHS repeat-containing protein (Protein is coded in complementary strand; from 8120217 to 8113639)