Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 779651
End position: 779674
Length: 24

DNA sequence
>NC_018266, from 779651 to 779674 (24 bp); Amycolatopsis mediterranei S699 CGACGCGGACGCCGCCGCCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 778393-780003	Sequence	AMES_0715 - subtilisin-like serine protease (Protein is coded in complementary strand; from 780003 to 778393)