Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7795209
End position: 7795233
Length: 25

DNA sequence
>NC_018266, from 7795209 to 7795233 (25 bp); Amycolatopsis mediterranei S699 CCGGCCCGCCGCGGCCCGGGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7794703-7796184	Sequence	AMES_6936 cobQ adenosylcobyric acid synthase (Protein is coded in complementary strand; from 7796184 to 7794703)