Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7781017
End position: 7781046
Length: 30

DNA sequence
>NC_018266, from 7781017 to 7781046 (30 bp); Amycolatopsis mediterranei S699 CCGCTGCGGCTGCCGGTGGCGCTGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7778905-7781607	Sequence	AMES_6925 - alpha-1,2-mannosidase (Protein is coded in complementary strand; from 7781607 to 7778905)