Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7593056
End position: 7593085
Length: 30

DNA sequence
>NC_018266, from 7593056 to 7593085 (30 bp); Amycolatopsis mediterranei S699 GACGTCGACGTGGCCGTCGCCGTCGAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7591746-7593719	Sequence	AMES_6766 - ASPIC/UnbV domain-containing protein (Protein is coded in complementary strand; from 7593719 to 7591746)