Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7397206
End position: 7397229
Length: 24

DNA sequence
>NC_018266, from 7397206 to 7397229 (24 bp); Amycolatopsis mediterranei S699 GCGGCGGCGACGGCGGCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7395083-7398025	Sequence	AMES_6608 - ribonuclease (Protein is coded in complementary strand; from 7398025 to 7395083)