Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7393152
End position: 7393175
Length: 24

DNA sequence
>NC_018266, from 7393152 to 7393175 (24 bp); Amycolatopsis mediterranei S699 CTCCGGCTCCAGCACCGGCTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7392739-7394196	Sequence	AMES_6605 obg GTP-binding protein Obg (Protein is coded in complementary strand; from 7394196 to 7392739)