Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7331473
End position: 7331508
Length: 36

DNA sequence
>NC_018266, from 7331473 to 7331508 (36 bp); Amycolatopsis mediterranei S699 TGCGCCAGCACCTGCGACAACACCAGCGCGAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7330663-7331655	Sequence	AMES_6542 baeS two-component system histidine kinase (Protein is coded in complementary strand; from 7331655 to 7330663)