Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7306224
End position: 7306247
Length: 24

DNA sequence
>NC_018266, from 7306224 to 7306247 (24 bp); Amycolatopsis mediterranei S699 CAGCGCCAGCACCACCGCCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7306006-7307049	Sequence	AMES_6513 - permease (Protein is coded in complementary strand; from 7307049 to 7306006)