Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7305783
End position: 7305809
Length: 27

DNA sequence
>NC_018266, from 7305783 to 7305809 (27 bp); Amycolatopsis mediterranei S699 CTTCGTGCTCGTCGTGCTCCTCGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7305272-7306009	Sequence	AMES_6512 - hypothetical protein (Protein is coded in complementary strand; from 7306009 to 7305272)