Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7134494
End position: 7134518
Length: 25

DNA sequence
>NC_018266, from 7134494 to 7134518 (25 bp); Amycolatopsis mediterranei S699 CGGCTCGACTCGGCTCGGGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7134000-7136117	Sequence	AMES_6356 - acyltransferase (Protein is coded in complementary strand; from 7136117 to 7134000)