Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7070656
End position: 7070679
Length: 24

DNA sequence
>NC_018266, from 7070656 to 7070679 (24 bp); Amycolatopsis mediterranei S699 TCGCCGTCGGCGTCGCGGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7070398-7071189	Sequence	AMES_6295 - ArsR family transcriptional regulator (Protein is coded in complementary strand; from 7071189 to 7070398)