Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7055841
End position: 7055867
Length: 27

DNA sequence
>NC_018266, from 7055841 to 7055867 (27 bp); Amycolatopsis mediterranei S699 CCGAAGTACCCGAAGTAGCCGAAGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7055795-7057024	Sequence	AMES_6280 - LytR family transcriptional regulator (Protein is coded in complementary strand; from 7057024 to 7055795)