Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 7023976
End position: 7023999
Length: 24

DNA sequence
>NC_018266, from 7023976 to 7023999 (24 bp); Amycolatopsis mediterranei S699 CACCGCCGCCGCCACCGGGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7021986-7025000	Sequence	AMES_6247 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 7025000 to 7021986)