Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6895819
End position: 6895842
Length: 24

DNA sequence
>NC_018266, from 6895819 to 6895842 (24 bp); Amycolatopsis mediterranei S699 TCCGGGGCCGGGTCCGGTCCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6895717-6900030	Sequence	AMES_6141 - condensation domain-containing protein involved in non-ribosomal peptide synthesis (Protein is coded in complementary strand; from 6900030 to 6895717)