Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6715978
End position: 6716013
Length: 36

DNA sequence
>NC_018266, from 6715978 to 6716013 (36 bp); Amycolatopsis mediterranei S699 CGGCTTCGTCGTCGTCCTCGTCGTCGAGTTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6713697-6716264	Sequence	AMES_5965 pheT phenylalanyl-tRNA synthetase beta chain (Protein is coded in complementary strand; from 6716264 to 6713697)