Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6630957
End position: 6630980
Length: 24

DNA sequence
>NC_018266, from 6630957 to 6630980 (24 bp); Amycolatopsis mediterranei S699 TGCCGATGCCCACGCCGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6629714-6631222	Sequence	AMES_5891 - sodium-coupled permease (Protein is coded in complementary strand; from 6631222 to 6629714)