Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6529643
End position: 6529678
Length: 36

DNA sequence
>NC_018266, from 6529643 to 6529678 (36 bp); Amycolatopsis mediterranei S699 CGTCGTGGTGGTCGGCGTGGTGGGCGTGGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6528378-6530612	Sequence	AMES_5799 xynA glycosyl hydrolase/beta-1,4-xylanase (Protein is coded in complementary strand; from 6530612 to 6528378)