Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6420587
End position: 6420610
Length: 24

DNA sequence
>NC_018266, from 6420587 to 6420610 (24 bp); Amycolatopsis mediterranei S699 GCCGTCGCGGTCGGCGTCGACGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6419715-6420947	Sequence	AMES_5711 - OmpA-OmpF porin, OOP family (Protein is coded in complementary strand; from 6420947 to 6419715)