Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6337048
End position: 6337071
Length: 24

DNA sequence
>NC_018266, from 6337048 to 6337071 (24 bp); Amycolatopsis mediterranei S699 ACGACCACGGCCACGACCACGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6335632-6337101	Sequence	AMES_5641 cvrA sodium/hydrogen exchanger (Protein is coded in complementary strand; from 6337101 to 6335632)