Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6052515
End position: 6052544
Length: 30

DNA sequence
>NC_018266, from 6052515 to 6052544 (30 bp); Amycolatopsis mediterranei S699 ACGTCGACGACGTCGTCGACGTAGACGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6052197-6053156	Sequence	AMES_5384 galE UDP-glucose 4-epimerase (Protein is coded in complementary strand; from 6053156 to 6052197)