Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6037716
End position: 6037742
Length: 27

DNA sequence
>NC_018266, from 6037716 to 6037742 (27 bp); Amycolatopsis mediterranei S699 CACAGTCGTCACAGTGGTCACAGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6036508-6037728	Sequence	AMES_5369 fabF 3-oxoacyl-[acyl-carrier-protein] synthase II (Protein is coded in complementary strand; from 6037728 to 6036508)
ORF... 6037743-6039002	Sequence	AMES_5370 fabF 3-oxoacyl-[acyl-carrier-protein] synthase II (Protein is coded in complementary strand; from 6039002 to 6037743)